esp3i restriction sites er0451 (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
esp3i restriction sites er0451
Esp3i Restriction Sites Er0451, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/esp3i+restriction+sites+er0451/esp3i/pmc11668309-82-36-41
Average 90 stars, based on 1 article reviews
Esp3i Restriction Sites Er0451, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/esp3i+restriction+sites+er0451/esp3i/pmc11668309-82-36-41
Average 90 stars, based on 1 article reviews
esp3i restriction sites er0451 - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: A prolactin-dependent sexually dimorphic mechanism of migraine chronification Article Snippet: Revolve microscope (Echo Laboratories Inc.) was used for fluorescence observation; images were taken with a 20× objective. .. Deletion of the total PRLR (PRLR-S and PRLR-L) was achieved by targeting the exon 1 of the prlr gene (ENSMUST00000128921.7) with a previously validated guide RNA (gRNA total PRLR: GTGTCAGGGGAACGACATTTG, quality score 97) inserted between the Article Title: A prolactin-dependent sexually dimorphic mechanism of migraine chronification. Article Snippet: Objective: Determination of possible sex differences in mechanisms promoting migraine progression and the contribution of prolactin and the prolactin long (PRLR-L) and short (PRLR-S) receptor isoforms.. Background: The majority of patients with chronic migraine and medication overuse headache are female.. Prolactin is present at higher levels in women and increases migraine. CRISPR:Article Title: A prolactin-dependent sexually dimorphic mechanism of migraine chronification. Article Snippet: Objective: Determination of possible sex differences in mechanisms promoting migraine progression and the contribution of prolactin and the prolactin long (PRLR-L) and short (PRLR-S) receptor isoforms.. Background: The majority of patients with chronic migraine and medication overuse headache are female.. Prolactin is present at higher levels in women and increases migraine. |